Tegangan yang dihasilkan actomyosin pada cadherin serupa antara sel epitel yang membelah dan yang tidak membelah pada embrio xenopus laevis awal | laporan ilmiah

Tegangan yang dihasilkan actomyosin pada cadherin serupa antara sel epitel yang membelah dan yang tidak membelah pada embrio xenopus laevis awal | laporan ilmiah

Anonim

Subjek

  • Fluoresensi biologis
  • Pencitraan seluler
  • Pencitraan fluoresensi
  • Protein fluoresen

Abstrak

Epithelia mewakili situasi unik di mana sel terpolarisasi harus mempertahankan kontak sel-sel yang cukup kuat untuk menjamin integritas epitel yang sangat diperlukan untuk fungsi penghalang. Namun demikian, epitel juga harus menjaga plastisitas yang cukup yang sangat penting selama pengembangan dan morfogenesis. Sambungan Adherens dan kekuatan mekanik yang dihasilkan oleh sitoskeleton actomyosin adalah pemain utama untuk pemeliharaan integritas epitel dan regulasi plastisitas. Untuk memahami bagaimana epitel dapat memenuhi tantangan seperti itu, sangat diperlukan untuk menentukan bagaimana sambungan seluler dan kekuatan mekanik yang bekerja pada persimpangan adherens diatur. Di sini, kami menyelidiki kekuatan tarik yang bekerja pada persimpangan adherens melalui cadherin selama pembelahan sel dalam epitel embrio Xenopus. Dengan menggunakan sensor ketegangan E-cadherin FRET yang baru-baru ini dikembangkan dan mikroskop prototipe fastFLIM, kami dapat mengukur kekuatan mekanik yang diterapkan pada cadherin di persimpangan sel-sel. Kami telah menunjukkan bahwa epitel Xenopus berada di bawah tekanan, sekitar 3 pN yang tetap stabil, menunjukkan bahwa gaya tarik yang bekerja pada cadherin di persimpangan adherens berada pada kesetimbangan. Tanpa diduga, ketegangan mekanis antar cadherin serupa antara sel epitel yang membelah dan yang tidak membelah.

pengantar

Morfogenesis didorong oleh peristiwa seluler seperti pembelahan, interkalasi atau ekstrusi. Kontraktilitas aktomiosin adalah peristiwa sentral dalam proses penting remodeling jaringan ini. Selama proses ini di epitel, integritas jaringan terus dipertahankan oleh pemeliharaan kontak sel-sel. Untuk tujuan ini, ketegangan kortikal dan adhesi sel-sel terkait erat 1 . Berlokasi di persimpangan adherens, cadherin adalah penghubung molekul langsung antara sel-sel tetangga 2 . Cadherin adalah protein transmembran yang domain ekstraselulernya menciptakan interaksi homofilik dengan cadherin sel tetangga dan yang secara tidak langsung menghubungkan, melalui hubungan catenin α dan β dengan ekor intracytoplasmic, aktin sitoskeleton 3 .

Uji traksi kekuatan mikroskop menggunakan substrat cadherin-dilapisi 4, 5, 6, pipet ganda atau substrat peregangan pada sel doublet 7, atau pinset optik pada manik-manik difungsikan dengan cadherin 8, 9 telah digunakan untuk menyelidiki peran mekanis cadherin dalam sel. Studi-studi ini menunjukkan korelasi langsung antara kekuatan pengikat cadherin ekstraseluler, ukuran persimpangan adherens dan generasi kekuatan oleh sel 4, 5, 6, 7, 8, 9 . Namun, peran cadherin dalam menghubungkan kejadian mekanik ekstraseluler dengan intraseluler masih belum jelas. Selain itu, percobaan mikroskop kekuatan traksi menunjukkan bahwa α-catenin yang dimediasi pengikatan cadherin dengan actomyosin bukan satu-satunya pengatur kontraktilitas sel pada substrat berlapis cadherin 10 . Studi lain menyajikan peran mekanis yang berbeda untuk P-cadherin dan E-cadherin; sedangkan P-cadherin memprediksi tingkat kekuatan antar sel, E-cadherin memprediksi tingkat di mana kekuatan antar sel 11 . Secara bersama-sama, peran yang tepat dari persimpangan cadherin tampak lebih kompleks dari sekedar pemancar tegangan.

Untuk semua pendekatan eksperimental yang disajikan di atas, mekanika sel diatasi pada tingkat sel dan peran mekanis cadherin pada tingkat molekulernya tidak dirasakan. Pendekatan baru-baru ini menggunakan modul sensor tegangan FRET 12 membawa visi baru dalam mekanika seluler. Dengan menggunakan modul sensor tegangan yang dikembangkan oleh Schwartz dan rekan penulis untuk vinculin 13, tegangan pada cadherin diselidiki dalam konteks substrat yang membentang pada adhesi sel doublet 14, migrasi sel perbatasan dalam oosit drosophila 15 dan tekanan geser pada sel endotel 16 . Menggunakan alat ini, isoform cadherin spesifik jaringan yang berbeda ditunjukkan untuk menunjukkan perilaku mekanik yang berbeda. Cortical E-cadherin menunjukkan peningkatan ketegangan selama peregangan sel doublet di situs adhesi fokus tetapi juga keluar dari situs adhesi sel-sel 14 . Sebaliknya, setelah penerapan gaya geser pada sel endotel, VE-cadherin menunjukkan penurunan ketegangan yang berkorelasi dengan peningkatan ketegangan di PECAM- 16 . Hasil awal ini tidak mendukung respons mekanis molekul sederhana dari cadherin melalui aplikasi eksternal atau internal dari ketegangan.

Selama pembelahan sel dalam epitel, deformasi membran terjadi selama sitokinesis di persimpangan adherens. Ini telah diselidiki secara intensif dalam drosophila 17, 18, 19, 20, tetapi mekanisme dimana proses ini didorong, dalam hal ketegangan molekul dan deformasi membran, tidak dipahami dengan baik 21, 22 . Apakah cadherin diregangkan oleh actomyosin di persimpangan adherens untuk menciptakan ketegangan dan deformasi membran? Apakah cadherin terlibat dalam stabilitas adhesi sel-sel untuk menjaga integritas jaringan? Bisakah cadherin secara bersamaan memainkan dua peran ini? Untuk menjelaskan pertanyaan-pertanyaan ini, kami telah menyelidiki ketegangan yang diterapkan pada cadherin selama pembelahan sel dalam epitel embrio Xenopus. Pada tahap blastula, pengamatan in situ terhadap pembelahan sel dimungkinkan karena sel-sel epitel terpolarisasi membelah dengan frekuensi tinggi pada permukaan organisme. Kami telah menggunakan pendekatan sensor tegangan E-cadherin FRET 14 dalam mengembangkan embrio Xenopus leavis . Menggunakan prototipe fastFLIM yang dikembangkan dalam tim 24 untuk pengukuran langsung efisiensi FRET, kami dapat mengukur kekuatan mekanik yang diterapkan pada cadherin di persimpangan sel-sel. Hasil kami menunjukkan bahwa, pada akhir tahap blastula, tegangan yang dihasilkan actomyosin pada cadherin adalah sekitar 3 pN dan tetap stabil selama pembelahan sel epitel.

Hasil

Sensor Ketegangan Cadherin menunjukkan penurunan FRET di persimpangan sel-sel dalam embrio Xenopus hidup, dibandingkan dengan kontrol yang lebih sedikit pada ekor.

Untuk menyelidiki kekuatan mekanik yang diterapkan pada cadherin pada persimpangan sel-sel dalam sel epitel embrio Xenopus, kami menggunakan biosensor tegangan E-cadherin (EcadTSMod, Gambar 1 dan 2a) yang sebelumnya dikembangkan oleh Borghi et al . 14 . Implementasi modul sensor tegangan (TSMod) antara domain transmembran dan domain pengikat catenin p120 tidak mempengaruhi lokalisasi cadherin dalam embrio Xenopus (Gbr. 2a). Dalam penelitian ini, kami mengukur FRET dengan Fluorescence Lifetime Imaging Microscopy (FLIM). Ketertarikan menggunakan FLIM untuk analisis biosensor dibandingkan analisis ratiometrik terletak pada fakta bahwa fluoresensi hanya diukur untuk protein donor, sehingga menghilangkan kemungkinan pendarahan spektral melalui pencitraan donor dan protein fluorescent akseptor. Untuk tujuan ini, kami mengembangkan mikroskop FastFLIM 24 yang kurang invasif dibandingkan dengan perangkat FLIM lainnya seperti TCSPC, dan memperoleh gambar seumur hidup fluoresensi dalam beberapa detik. Umur fluoresensi protein donor dipengaruhi oleh fenomena FRET. Hubungan antara masa pakai fluoresensi dan FRET adalah terbalik, yang berarti semakin banyak penurunan masa pakai fluoresensi, semakin banyak FRET terjadi, dan berbanding terbalik (Gbr. 1). Dalam contoh TSMod, dengan tidak adanya kekuatan, FRET maksimum, ini sesuai dengan FLIM dengan masa berfluoresensi rendah dibandingkan dengan donor saja. Di hadapan kekuatan, FRET berkurang, oleh karena itu masa fluoresensi meningkat hingga nilai donor saja. Usia fluoresensi rata-rata EcadTSMod yang diukur dengan mikroskop FastFLIM adalah 2.594 ± 51 ps (Gbr. 2a, b). Sistem fastFLIM didasarkan pada piringan berputar, sehingga ukuran yang dilakukan dibatasi pada persimpangan adherens, yang terletak di kutub apikal sel. Seperti yang diharapkan, masa pakai fluoresensi donor cadherin saja (EcadTI) yang tidak memiliki protein fluoresen YFP secara signifikan lebih tinggi, pada 2.724 ± 31 ps (Gambar 2a, b). Hasil ini menunjukkan bahwa EcadTSMod mampu FRET dalam embrio. Yang penting, masa berfluoresensi konstruk kurang-ekor cadherin (EcadTL) di mana ekor sitoplasmik E-cadherin yang bertanggung jawab atas perlekatan aktin hilang adalah 2, 476 ± 52 ps (Gbr. 2a, b). Umur fluoresensi ini secara signifikan lebih kecil dari EcadTSMod sehingga menunjukkan modulasi efisiensi FRET yang disebabkan oleh hubungan EcadTSMod dengan sitoskeleton actomyosin. Ini juga menunjukkan bahwa dalam embrio Xenopus, kekuatan mekanik yang dihasilkan oleh sitoskeleton actomyosin dapat terlibat dalam produksi kekuatan yang diterapkan pada EcadTSMod di persimpangan adherens, seperti yang sebelumnya ditunjukkan dalam sel-sel MDCK 14 .

Image

Representasi skematis dari biosensor EcadTSMod. Dengan tidak adanya tegangan (atas) TSMod tidak memanjang, jarak antara dua protein fluorescent adalah yang terpendek, yang berarti bahwa FRET maksimum. Karena hubungan antara FRET dan masa pakai fluoresensi donor terbalik, jika tidak ada ketegangan, masa pakai fluoresensi donor rendah. Di hadapan kekuatan (bawah) TSMod memanjang, jarak antara protein fluoresen meningkat, FRET menurun dan masa hidup fluoresensi donor meningkat.

Gambar ukuran penuh

Image

( a ) Representasi skematis dari berbagai konstruksi yang digunakan, menunjukkan daerah pengikat p120 catenin, β-catenin dan pengikatan tidak langsung α-catenin dan aktin, dan lokalisasi masing-masing dalam sel epitel Xenopus laevis blastula (fluoresensi), masing-masing bidang pandang terdiri dari sekitar 15 hingga 20 sel pada tahap perkembangan ini. Gambar umur fluoresensi disajikan untuk semua konstruksi (umur fluoresensi). ( B) Boxplot mewakili masa pakai fluoresensi rata-rata per bidang yang diperoleh atas semua akuisisi untuk berbagai konstruksi. Jumlah akuisisi N acq = 48, 105 dan 44, jumlah percobaan independen N exp = 10, 14, 6 dan jumlah embrio N emb = 22, 55, 15, untuk masing-masing EcadTI, EcadTSMod dan EcadTL. Untuk setiap perbandingan, nilai p ditunjukkan. Dalam plot kotak, bold bar sesuai dengan nilai median, kumis dengan nilai 1, 5x dari kuartil ke-1 dan ke-3, dan titik-titik ke outlier.

Gambar ukuran penuh

Biosensor EcadTSMod dikembangkan dari canine E-cadherin. Dimodelkan pada EcadTSMod, kami membangun biosensensor CcadTSMod dengan memasukkan TSMod dalam Xenopus C-cadherin yang diekspresikan secara maternal dan merupakan cadherin utama pada embrio awal 25 . Lokalisasi CcadTSMod sama dengan EcadTSMod (bandingkan Gambar. S1a dengan Gambar. 2a). Umur fluoresensi CcadTSMod adalah 2.616 ± 53 ps (Gambar. S1b). Hasil ini menunjukkan bahwa EcadTSMod yang heterolog dan CcadTSMod yang homolog menampilkan daya tahan fluoresensi yang serupa. Oleh karena itu, percobaan selanjutnya dilakukan dengan EcadTSMod dan divalidasi dengan CcadTSMod seperti yang ditunjukkan.

Sensor tegangan Cadherin mampu mengukur variasi tegangan in vivo

Seperti yang ditentukan sebelumnya oleh peregangan molekul tunggal, penghubung elastis yang dimasukkan antara mTFP1 dan YFP dalam TSMod, responsif untuk gaya mulai dari 0 hingga 7 pN 13 . Namun, resolusi spasial dari sistem FastFLIM kami memungkinkan untuk mengukur usia fluoresensi rata-rata dari beberapa molekul yang terlokalisasi pada waktu yang sama dalam volume akuisisi yang sama. Ini mengangkat dua kemungkinan berikut: masa fluoresensi rata-rata yang kami ukur sebenarnya bisa dihasilkan dari beberapa molekul EcadTSMod yang dikirimkan ke berbagai kekuatan yang terdiri antara 0 dan 7 pN atau dari dua populasi EcadTSMod yang berbeda. Di antara dua populasi ini, satu populasi akan berada di bawah ketegangan maksimal (ON) dan yang kedua di bawah tidak ada ketegangan sama sekali (OFF). Untuk menguji dua kemungkinan ini, kami menganalisis korelasi antara masa hidup fluoresensi dan intensitas fluoresensi. Memang, jika rata-rata FRET mencerminkan kekuatan nyata maka masa fluoresensi seharusnya tidak bergantung pada intensitas fluoresensi. Sebaliknya, jika FRET memantulkan campuran keadaan ON dan OFF, maka dua kuantitas harus berbeda mengikuti tingkat ekspresi sensor dan umur yang diukur harus bergantung secara linear pada intensitas fluoresensi. Satu kurva representatif dari intensitas fluoresensi versus masa fluoresensi bidang disajikan pada Gambar. 3a. Persamaan rata-rata yang diperoleh untuk 10 percobaan independen adalah y = 0, 0037x + 2, 548 dan nilai rata-rata R2 adalah 0, 013. Jadi sebagian besar data umur fluoresensi tidak berkorelasi dengan intensitas fluoresensi. Hasil serupa diperoleh dengan CcadTSMod (Gbr. S2a). Hasil kami mendukung hipotesis di mana hasil rata-rata masa pakai fluoresensi dari banyak molekul mengalami berbagai kekuatan yang terdiri antara 0 dan 7 pN. Oleh karena itu menunjukkan bahwa biosensor EcadTSMod mengalami ketegangan dalam embrio dan itu tidak tergantung pada jumlah cadherin yang terintegrasi dalam persimpangan.

Image

( a ) Plot sebar dari masa fluoresensi vs intensitas fluoresensi untuk setiap piksel dari akuisisi yang representatif. Persamaan regresi linier ditentukan di sudut kanan atas. ( B ) Imunofluoresensi tidak langsung dari EcadTSMod terdeteksi dengan antibodi anti-GFP (hijau) dan catenin α, β dan p120 (merah) dalam Xenopus laevis blastula yang mengekspresikan protein EcadTSMod secara berlebihan. Garis dapat dibuat pada garis putus-putus yang ditunjukkan, dan intensitas fluoresensi yang dinormalisasi ditunjukkan untuk kedua saluran (hijau untuk EcadTSMod dan merah untuk catenin) dalam grafik yang sesuai. Skala bar, 20 μm. ( C ) Boxplot pasukan berarti diterapkan pada EcadTSMod di embrio yang tidak diobati atau embrio diperlakukan dengan EGTA, latrunculin A, morpholino terhadap α-catenin (MO α-catenin) dan Calyculin A, dengan masing-masing 105, 32, 37, 44 dan 29 bidang independen (jumlah percobaan masing-masing: 14, 2, 2, 2 dan 3; masing-masing jumlah embrio: 55, 16, 19, 22 dan 15). Untuk setiap perbandingan, nilai p ditunjukkan. Dalam plot kotak, bold bar sesuai dengan nilai median, kumis dengan nilai 1, 5x dari kuartil ke-1 dan ke-3, dan titik ke outlier.

Gambar ukuran penuh

Untuk lebih lanjut menunjukkan bahwa biosensor EcadTSMod terintegrasi dengan baik di persimpangan dan terkait dengan regulatornya, kami menganalisis ekspresi catenin α, β dan p120 dalam sel yang diekspresikan secara berlebihan oleh EcadTSMod. Pemindaian garis di persimpangan sel yang berbeda menghadirkan perekrutan EcadTSmod dan catenin yang berbeda secara simultan (Gbr. 3b). Catenin terlokalisasi dengan benar di persimpangan saat EcadTSmod diekspresikan. Oleh karena itu, hasil kami menunjukkan bahwa biosensor adalah alat yang bermakna untuk pengukuran gaya in vivo .

Selanjutnya, untuk mengubah masa pakai fluoresensi menjadi intensitas kekuatan, kami menyesuaikan kalibrasi yang digunakan oleh Grashoff et al . 13, dan menyesuaikannya dengan pengukuran FLIM menggunakan pasangan protein fluorescent FRET mTFP1 / YFP. Proses perhitungan dirinci dalam bahan pelengkap dan kurva kalibrasi yang dihasilkan ditunjukkan pada Gambar. S3a. Persamaan kalibrasi yang dihasilkan adalah y = 0, 0292x - 72, 597, di mana y menunjukkan gaya dalam pN dan x umur fluoresensi yang dinyatakan dalam picoseconds. Persamaan ini memungkinkan menghitung gaya rata-rata yang diterapkan lintas EcadTSMod dalam embrio Xenopus (Gbr. S3b), dengan nilai 3, 16 ± 1, 50 pN (Gbr. 3c).

Untuk menguji apakah EcadTSMod dapat mendeteksi variasi intensitas kekuatan in vivo , kami mengubah tegangan pada embrio Xenopus secara kondisional dan kemudian mengukur dampak perubahan tegangan tersebut pada masa pakai fluoresensi EcadTSMod. Karena, cadherin adalah protein transmembran yang terkait dengan cadherin sel-sel tetangga melalui domain ekstraselulernya dan ke sitoskeleton aktin melalui hubungan catenin pada ekor intracytoplasmic, ada dua cara untuk memodifikasi kekuatan in vivo : baik dengan bekerja pada cadher ekstraseluler. interaksi cadherin atau pada hubungan aktin.

Karena cadherin adalah protein adhesi yang bergantung pada kalsium, embrio yang mengekspresikan EcadTSMod dirawat dengan 3 mM EGTA untuk mengganggu interaksi homofilik. Setelah 20 menit perawatan, sel lokal membungkuk dan dalam beberapa kasus pemisahan sel tetangga dapat diamati (tidak ditunjukkan). Embrio-embrio itu dibuang untuk menganalisis hanya embrio di mana antarmuka sel tidak terganggu. Seperti yang diharapkan, penurunan intensitas kekuatan yang diterapkan pada EcadTSMod diukur, dengan nilai rata-rata 2, 04 ± 0, 87 pN (Gbr. 3c). Demikian pula, masa hidup fluoresensi CcadTSMod berkurang (Gbr. S2b).

Karena gaya yang diberikan pada sensor EcadTSMod juga tergantung pada sitoskeleton aktin 14 yang utuh, kami berupaya mengurangi intensitas gaya dengan menggunakan latrunculin A untuk mengganggu filamen aktin. Embrio yang mengekspresikan EcadTSMod yang dirawat dengan latrunculin A 5 M, menunjukkan penurunan intensitas gaya dengan nilai rata-rata 1, 50 ± 1, 65 pN (Gambar 3c). Karena paparan embrio terhadap Latrunculin A dapat menyebabkan hilangnya adhesi sel-sel seperti untuk pengobatan EGTA, kami menganalisis hanya embrio dengan antarmuka sel-sel yang utuh. Kami tidak mengamati perubahan seumur hidup fluoresensi setiap saat setelah perawatan (dari 5 hingga 30 menit, data tidak ditampilkan). Hasil yang sama diperoleh untuk CcadTSMod (Gbr. S2b). Kekuatan residu yang masih kami amati mungkin timbul dari adanya sisa filamen aktin, karena pengobatan dengan latrunculin A tidak sepenuhnya efektif. Memang, imunofluoresensi aktin setelah latrunculin A pengobatan menunjukkan penurunan pewarnaan sitoskeleton aktin, tetapi beberapa filamen aktin masih terdeteksi (Gbr. S4).

Selain pengobatan EGTA dan latrunculin A, kami juga merobohkan ekspresi α-catenin. Karena α-catenin secara tidak langsung menghubungkan cadherin ke sitoskeleton actomyosin, penurunan α-catenin di persimpangan harus menyebabkan penurunan ketegangan karena hilangnya hubungan cadherin dengan sitoskeleton aktin. Kami menggunakan morfolino yang dijelaskan sebelumnya terhadap α-catenin, terbukti mengurangi secara efektif ekspresi α-catenin pada embrio xenopus 26 . Di tangan kami, Embryo yang disuntikkan bersama dengan EcadTSMod dan morpholino terhadap α-catenin menunjukkan penurunan signifikan ekspresi α-catenin (Gbr. S5). Seperti yang diharapkan, penurunan ekspresi α-catenin disertai oleh penurunan kekuatan yang signifikan (Gambar 3c) dengan nilai rata-rata 1, 78 ± 0, 76 pN. Efek ini juga diperoleh untuk CcadTSMod (Gbr. S2b).

Eksperimen ini menunjukkan bahwa dengan mengurangi kontraktilitas aktin atau dengan mengganggu hubungan cadherin kita dapat mengukur penurunan gaya menggunakan biosensor EcadTSMod. Untuk menunjukkan bahwa kami juga dapat mengukur peningkatan ketegangan, kami memperlakukan embrio dengan Calyculin A. Calyculin A adalah inhibitor fosfatase yang menghambat myosin-light-chain phosphatase, yang menginduksi hiperaktifasi myosin dan mengarah ke meningkatkan kontraktilitas 27 . Pengobatan embrio yang mengekspresikan EcadTSMod dengan 0, 5 μM Calyculin A selama 90 menit menginduksi peningkatan ketegangan yang signifikan (Gbr. 3c), dengan nilai rata-rata 4, 52 ± 1, 20 pN. Efek yang sama diperoleh untuk CcadTSMod (Gbr. S2b). Hasil ini menunjukkan bahwa biosensor EcadTSMod dan CcadTSMod mendeteksi penurunan dan peningkatan ketegangan.

Ketegangan lintas cadherin serupa pada sel yang tidak membelah dan selama pembelahan sel

Keuntungan utama dari prototipe FastFLIM kami adalah memungkinkan dilakukannya gambar FLIM dalam beberapa puluh detik. Oleh karena itu kami menggunakan FastFLIM untuk membuat pengukuran temporal dari fluoresensi seumur hidup pada embrio hidup untuk mendeteksi kekuatan dari waktu ke waktu. Untuk tujuan ini, masa hidup fluoresensi dari EcadTSMod, EcadTL dan EcadTI diukur selama beberapa menit, biasanya 15 menit dan untuk setiap konstruk. Fluktuasi masa hidup fluoresensi dari waktu ke waktu persimpangan khas ditampilkan sebagai kimograf (Gambar 4a, garis merah putus-putus). Untuk setiap kymograph, ada variabilitas spasial dan temporal yang tinggi dari masa fluoresensi. Namun, usia fluoresensi rata-rata stabil sepanjang membran yang dianalisis dari waktu ke waktu (Gambar 4b) dan mewakili nilai rata-rata yang ditunjukkan sebelumnya (Gambar 2). Analisis yang sama dilakukan dengan CcadTSMod (Gbr. S6a) dan menunjukkan bahwa masa fluoresensi juga stabil dari waktu ke waktu di persimpangan sel-sel (Gbr. S6b). Deviasi standar mencerminkan kesalahan pengukuran dan menampilkan variabilitas spasial dari masa fluoresensi. Nilai ini serupa untuk ketiga konstruk yang berarti bahwa itu tidak tergantung kondisi. Yang penting, variabilitas intra-embrio serupa untuk ketiga konstruk, yang berpotensi mencerminkan variabilitas yang berasal dari pengaturan custom-built fastFLIM. Oleh karena itu, kami menyimpulkan bahwa setiap perubahan yang dimasukkan ke dalam variabilitas itu tidak dapat dikaitkan dengan variasi tegangan mekanis. Deviasi standar yang ditunjukkan di sini mencerminkan variabilitas intra-embrio, sedangkan yang ditunjukkan pada Gambar. 2 mencerminkan variabilitas antar-embrio. Kedua standar deviasi serupa menunjukkan bahwa variabilitas antar-embrio mungkin terutama memperhitungkan variabilitas intra-embrio. Sebagai kesimpulan, hasil kami menunjukkan bahwa pengukuran kekuatan yang diterapkan pada EcadTSMod atau CcadTSMod stabil dari waktu ke waktu di blastula, menunjukkan bahwa ketegangan cadherin pada persimpangan sel-sel berada pada kesetimbangan dalam embrio.

Image

( a ) Pengambilan sementara EcadTSMod, EcadTL dan EcadTI di Xenopus blastula. Gambar fluoresensi disajikan di baris atas; baris bawah sesuai dengan gambar seumur hidup fluoresensi. Untuk setiap konstruk, 3 titik waktu disajikan 1, 7 dan 14 menit. Sebuah kymograph dari seluruh akuisisi temporal diwakili di bagian kanan, koordinat XY yang sesuai ditunjukkan oleh garis putus-putus dalam gambar fluoresensi. ( B ) Masa hidup fluoresensi rata-rata dan standar deviasi semua koordinat XY selama seri waktu untuk EcadTI (ungu), EcadTSMod (cyan) dan EcadTL (hijau). Nilai mewakili rata-rata ± SD.

Gambar ukuran penuh

Karena gaya tetap stabil dari waktu ke waktu, kami menguji apakah intensitas gaya yang diterapkan pada perubahan cadherin selama pembelahan sel. Memang, ketika cincin actomyosin sitokinetik diposisikan tegak lurus terhadap bidang epitel, ia menghasilkan deformasi persimpangan sel-sel dan memungkinkan ingresi membran plasma. Ini pada akhirnya mengarah pada pembentukan membran dan persimpangan baru antara dua sel anak dan antara sel anak dengan tetangga mereka. Nilai kekuatan rata-rata dari seluruh bidang akuisisi di mana sel membelah (3, 50 pN ± 1, 72, n = 30) mirip dengan yang ada di bidang tanpa membagi sel (2, 81 pN ± 1, 68, n = 42, pvalue = 0, 1089). Dalam sel yang menjalani sitokinesis kami menganalisis, dari waktu ke waktu, ketegangan secara khusus diterapkan pada membran plasma yang diregangkan oleh kontraksi actomyosin. Hasil yang representatif ditunjukkan pada Gambar. 5a. Seperti dalam kasus sel-sel yang tidak membelah, kekuatan EcadTSMod tidak berubah secara signifikan bahkan di lokasi di mana membran ditarik. Analisis yang sama dilakukan dengan EcadTL (Gambar. S7a dan c) dan EcadTI (Gambar. S7b dan c) kontrol, dalam kedua kasus masa fluoresensi stabil sepanjang membran dan di lokasi divisi. Untuk EcadTSMod, gaya rata-rata yang diterapkan selama pembelahan sel dan deviasi standar serupa di sepanjang berbagai piksel membran (Gbr. 5b) dan di lokasi pembelahan (panah) dari waktu ke waktu untuk percobaan yang representatif. Deviasi standar di sini menunjukkan variasi dari waktu ke waktu untuk posisi tertentu pada membran, oleh karena itu kami tidak melihat perubahan dalam amplitudo variasi di situs pembagi (panah) dan di tempat lain di membran. Analisis yang sama dilakukan untuk CcadTSMod (Gbr. S8a dan b) dan menunjukkan bahwa masa fluoresensi juga stabil selama pembelahan sel ketika CcadTSMod diekspresikan.

Image

( a ) Pengambilan spatio-temporal dari gambar fluoresensi EcadTSMod dan gambar gaya yang sesuai pada titik waktu yang berbeda. Pada gambar fluoresensi, panah hitam mengarah ke situs divisi dan garis putus-putus menunjukkan kontak sel-sel yang disajikan sebagai kimograf di bawah ini. Resolusi sementara adalah 1 gambar setiap 20 detik. Panah vertikal pada kymograph menunjukkan situs divisi sementara yang horisontal menandai waktu mulai kontraksi. Panjang kimograf bervariasi dari waktu ke waktu karena peregangan membran selama pembelahan. ( B ) Kekuatan rata-rata dan standar deviasi semua koordinat XY selama deret waktu untuk EcadTSMod dalam membagi sel epitel embrio Xenopus, kepala panah menunjukkan situs divisi. Nilai mewakili rata-rata ± SD. ( c, d ) Rasio gaya yang diukur di situs pembagi dan pada membran proksimal ( c ) atau pada membran distal pada sel yang tidak membelah ( d ), selama perkembangan pembelahan sel. Gaya diukur pada titik waktu yang sama di situs pembagi dan di suatu wilayah di membran proksimal atau distal. Persentase kemajuan divisi yang sesuai dihitung dengan mengukur jarak dari dua titik pembagian. Grafik menunjukkan hasil yang diperoleh untuk 44 situs pembelahan (yang mewakili 7 percobaan independen, 18 embrio dan 27 sel). Dalam plot kotak, bold bar sesuai dengan nilai median, kumis dengan nilai 1, 5x dari kuartil ke-1 dan ke-3, dan titik-titik ke outlier.

Gambar ukuran penuh

Menggunakan EcadTSMod kami menganalisis kekuatan selama pembelahan sel, untuk data pembelahan sel 27, di tiga wilayah yang berbeda; di situs pembelahan, daerah proksimal pada membran yang mengalami ingresi, dan daerah distal pada membran sel yang tidak membelah. Rasio gaya di situs pembagi dan pada membran proksimal ditunjukkan pada Gambar. 5c. Selama pembelahan sel, rasionya mendekati 1, dengan nilai median antara 0, 93 dan 1, 19, dan tidak ada variasi signifikan yang diamati. Ini berarti bahwa gaya di situs divisi mirip dengan yang diterapkan pada membran yang sama di daerah yang tidak mengalami ingresi. Sebaliknya, gaya normal yang diperoleh untuk embrio yang dirawat dengan Calyculin A (Calyculin A / embrio yang tidak diolah dengan tekanan), Gambar 3c), menunjukkan nilai median 1, 43 yang secara signifikan lebih tinggi daripada yang diamati dengan EcadTSmod selama pembelahan sel. Ini menegaskan tidak adanya ketegangan yang kuat di lokasi divisi. Hasil yang sama diperoleh ketika membandingkan gaya dengan daerah pada membran distal pada sel yang tidak membelah, dengan nilai median termasuk antara 0, 76 dan 1, 26 (Gbr. 5d), yang berarti bahwa masa fluoresensi yang diamati di lokasi pembagian juga serupa. untuk yang diperoleh pada membran sel yang tidak mengalami pembelahan. Analisis serupa dilakukan untuk CcadTSMod, menggunakan nilai-nilai seumur hidup fluoresensi (Gbr. S8c dan d untuk data pembagian 11 sel), dan juga ditunjukkan untuk konstruksi ini bahwa rasio mendekati 1 untuk membran proksimal dan distal dan tidak berubah selama progres pembelahan sel. Hasil ini menunjukkan bahwa selama pembelahan sel, kekuatan di seluruh biosensor EcadTSMod dan CcadTSMod mirip dengan sel yang tidak membelah. Ini juga menunjukkan bahwa ketegangan yang dihasilkan actomyosin pada cadherin stabil dalam embrio berkembang termasuk selama proses sitokinesis.

Diskusi

Menggunakan sensor tegangan EcadTSmod yang dijelaskan sebelumnya 14 dan CcadTSMod kami, kami telah menunjukkan bahwa cadherin berada di bawah tekanan dalam epitel Xenopus blastulae dan bahwa gaya tarik dihasilkan oleh sitoskeleton actomyosin. Kami juga telah menunjukkan bahwa tegangan stabil dari waktu ke waktu, yang menunjukkan bahwa dalam embrio, keseluruhan ketegangan yang diterapkan pada cadherin berada pada kesetimbangan. Selain itu, kami menunjukkan bahwa selama pembelahan sel, gaya mekanik yang diterapkan pada cadherin tidak berubah secara signifikan.

Menggunakan anti-C-cadherin morpholinos yang berhasil menghabiskan protein dalam gastrula 28 kami tidak dapat merobohkan ekspresi C-cadherin di blastula, mungkin karena persediaan protein C-cadherin yang sudah ada dalam telur 25, 29 . Ini mencegah kami untuk secara langsung menguji fungsionalitas sensor tegangan pada embrio yang kadherin habis. Baik EcadTSMod dan CcadTSMod terintegrasi ke dalam persimpangan embrio Xenopus yang hidup dan tidak mengganggu lokalisasi protein catenin yang penting untuk fungsinya dan merespons berbagai rangsangan. Oleh karena itu, data kami menunjukkan bahwa mereka berfungsi penuh. Anehnya, tidak satu pun dari berbagai perawatan yang digunakan untuk mengubah intensitas kekuatan mampu sepenuhnya menghilangkan kekuatan yang diukur oleh konstruk EcadTL. Ini bisa dijelaskan dengan efek parsial dari perawatan latrunculin-A, EGTA atau α-catenin morpholino. Namun demikian, perawatan tersebut secara signifikan mengurangi kekuatan yang diterapkan pada EcadTSMod dan CcadTSMod, sehingga menunjukkan bahwa probe ini memang di bawah tekanan mekanis pada epitel embrio Xenopus.

Kecuali untuk variabilitas di sekitar nilai gaya rata-rata, kami tidak dapat mendeteksi variasi yang jauh lebih tinggi. Kami tidak dapat mengecualikan kemungkinan bahwa variasi kecil dapat terjadi tetapi mereka tidak dapat diukur karena akan dimasukkan dalam kesalahan pengukuran. Untuk mendeteksi variasi sekecil itu akan membutuhkan pengaturan mikroskop yang lebih sensitif dan lebih cepat. Dengan demikian, hasil kami menunjukkan bahwa kekuatan yang diterapkan pada cadherin dalam embrio blastula stabil. Ketegangan rata-rata melintasi cadherin dalam epitel embrio Xenopus diukur dengan dua biosensor tegangan (ECadTSMod dan CCadTSMod) adalah sekitar 3 pN. Menariknya, nilai ini hanya sedikit lebih tinggi dari 1-2 pN yang diukur dengan ECadTSMod dalam sel kultur mamalia 14 . Perbedaan kecil ini dapat disebabkan oleh variasi eksperimental. Namun, peregangan sepasang sel menghasilkan peningkatan kekuatan 1 pN yang sederhana namun signifikan pada kontak sel-sel 14 . Oleh karena itu, nilai intensitas kekuatan 1–2 pN yang lebih tinggi yang diukur dalam epitel embrio Xenopus dapat mencerminkan perbedaan yang signifikan antara kedua sistem biologis. Memang, juga mungkin bahwa sambungan adherens sel-sel epitel kontinyu seperti yang ada di permukaan Xenopus blastula dikirim ke kekuatan yang lebih kuat (lebih unggul dari 7 pN dan dengan demikian tidak terdeteksi dengan probe yang dioptimalkan untuk 0–7). rentang pN, seperti halnya untuk EcadTSMod dan CcadTSMod). Untuk memiliki pemahaman yang jelas tentang bagaimana jaringan dan lingkungan sel memengaruhi kekuatan yang diterapkan pada persimpangan sel-sel, penelitian selanjutnya akan diperlukan untuk membandingkan berbagai jenis sensor epitel atau sensor ketegangan baru.

Karena sensor tegangan dapat digunakan untuk mengukur kekuatan in vivo , kami berusaha menganalisis kekuatan yang diterapkan di persimpangan adherens selama sitokinesis, langkah terakhir pembelahan sel. Sitokinesis melibatkan cincin aktin-myosin kontraktil yang merusak membran plasma dan korteks sitoskeleton terkait sehingga pada akhirnya mengarah ke pemisahan dua sel anak. Untuk menguji kemungkinan bahwa gaya yang diterapkan pada persimpangan adherens melalui cadherin akan berubah selama pembelahan sel dalam epitel embrio, kami mengukur ketegangan menggunakan dua biosensor yang sebelumnya divalidasi. Kecuali variasi yang melekat pada pengukuran, kami tidak mendeteksi perubahan signifikan pada tegangan di sepanjang membran yang berarti bahwa cadherin dikirimkan ke gaya tarik yang berada pada kesetimbangan.

Sangat menarik, hasil kami menunjukkan bahwa selama sitokinesis dalam epitel embrio Xenopus, ingresi membran tidak melibatkan perubahan besar dalam gaya tarik yang dihasilkan oleh sitoskeleton acto-myosin pada cadherin. Oleh karena itu, dua hipotesis dapat diajukan untuk menjelaskan perpindahan persimpangan adherens selama sitokinesis. Pertama, tidak ada perubahan intensitas kekuatan pada cadherin yang terjadi selama sitokinesis. Ini akan menyiratkan bahwa gaya yang dihasilkan oleh cincin sitokinetik kontraktil menghasilkan ingresi membran plasma dengan bertindak secara eksklusif pada struktur yang berbeda dari persimpangan adherens. Namun, kemungkinan ini tampaknya tidak mungkin karena persimpangan adherens diperlukan untuk menahan cincin sitokinetik dalam Drosophila 18, meskipun kami tidak dapat mengecualikan bahwa mekanisme ini berbeda pada lalat dan katak. Memang, interaksi dari persimpangan adherens dan persimpangan ketat selama sitokinesis baru-baru ini diselidiki dalam embrio Xenopus yang menunjukkan bahwa persimpangan ketat dipertahankan selama sitokinesis 30 . Dapat dibayangkan bahwa cadherin memang terlibat dalam stabilitas adhesi sel-sel untuk menjaga integritas jaringan, sementara struktur lain mengalami ingresi yang digerakkan secara paksa. Atau, gaya tarik tidak seimbang diterapkan pada cadherin selama sitokinesis di lokasi ingresi membran. Baru-baru ini diperlihatkan bahwa vinculin, protein pengikat F-aktin yang telah digunakan untuk mendeteksi ketegangan junctional in vivo 31, direkrut di lokasi divisi 30 . Jika ada gaya tarik yang tidak seimbang pada cadherin, ada kekuatan pada cadherin yang diubah secara sepihak dalam pembelahan atau dalam sel tetangga, atau kekuatan meningkat dalam sel pembagi dan menurun secara timbal balik dalam sel-sel tetangga. Mempertimbangkan hasil kami, perubahan akan agak sederhana dalam kasus sebelumnya, karena tidak akan melebihi variabilitas pengukuran (sekitar 1, 6 pN). Dalam kasus terakhir, perubahan kekuatan timbal balik akan menghasilkan ketegangan global yang tidak berubah, seperti yang kami soroti. Apakah ketidakseimbangan ini unilateral atau bilateral, akan penting untuk mengungkap mekanisme yang menyebabkan ingresi membran dalam membagi sel.

Deformasi struktur tidak hanya bergantung pada intensitas kekuatan sesaat tetapi juga pada temporal signature-nya. Cadherin dilokalkan secara dinamis di persimpangan adherens. Menggunakan mikroskop kuantitatif superresolusi 3D dalam embrio Drosophila, telah ditunjukkan bahwa pengelompokan E-cadherin diatur secara halus melalui endositosis dan interaksi dengan filamen aktin 32 . Menggunakan pemulihan fluoresensi setelah pengukuran photobleaching pada embrio Xenopus, telah dilaporkan bahwa cadherin distabilkan pada alur pembelahan 30 . Dalam pengertian itu, dinamika cadherin pada membran plasma bisa menjadi mekanisme utama yang menyebabkan deformasi membran.

Dengan menggunakan perkembangan baru dalam mikroskop fluoresensi kuantitatif untuk mengukur dinamika spatio-temporal dari ketegangan molekuler, kami menyajikan hasil yang tidak terduga di mana cadherin tampaknya tidak secara langsung diregangkan untuk menciptakan deformasi membran selama sitokinesis sel epitel dalam vertebrata. Pekerjaan kami membuka jalan untuk mengungkap mekanisme molekuler yang mengarah ke membran ingresi dalam sel pembagi epitel vertebrata.

Material dan metode

Konstruksi plasmid dan transkripsi in vitro

pT7T-EcadTSMod, pT7T-EcadTL, pT7T-EcadTI, pT7T-CcadTSMod diperoleh dengan amplifikasi PCR dari EcadTSMod, EcadTL, dan EcadTI plasmid (jenis hadiah dari Dr. N. Borghi) dan C-cadherin cDNA (mohon disediakan oleh Dr. BM) Gumbiner), masing-masing. Produk PCR dikloning antara situs BglII dan SpeI ke dalam vektor pT7T menggunakan NEB Gibson assembly kit (NEB). pT7-CcadTSMod dibangun dengan kit perakitan NEB Gibson mengikuti skema yang sama seperti untuk EcadTSMod: pengkodean urutan untuk asam amino pertama C-cadherin dimasukkan setelah situs BglII pT7T, modul TS yang berisi protein sutra laba-laba diapit oleh mTFP1, EYFP dan glycine linker di setiap sisi, dimasukkan tepat setelah fragmen pertama. 146 asam amino terakhir C-cadherin kemudian dimasukkan antara modul TS dan situs SpeI pT7T. Konstruk diverifikasi oleh urutan. Transkripsi in-vitro dilakukan dengan kit transkripsi mMessage mMachine sesuai dengan instruksi pabrik (Ambion) menggunakan situs EcoRI untuk linierisasi.

Persiapan, injeksi mikro, terapi obat dan imunofluoresensi tidak langsung embrio Xenopus

Orang dewasa Xenopus laevis albino diperoleh dari Pusat Sumber Daya Biologis (CRB, Rennes, Prancis). Embrio disiapkan dan diinjeksi mikro seperti dijelaskan sebelumnya 33 . Setelah injeksi mikro, embrio disimpan dalam ficoll PM400 5% (F4375, Sigma) dalam F1 (NaCl, 31, 25 mM; KCl, 1, 75 mM; CaCl 2, 1, 0 mM; MgCl 2, 0, 06 mM; Hepes, 10 mM, pH 7, 8 34 ), semalam pada suhu 14 ° C sampai mencapai blastula (tahap 9 35 ). Untuk percobaan pencitraan, slide kaca disiapkan dengan tiga spacer Bingkai Gen superposis (AB-0577-Thermoscientific) dan diisi dengan ficoll 5%. Embrio ditempatkan di ruang-ruang ini dengan tiang vegetal menghadap seluncuran kaca, ditutupi dengan kaca penutup dan diamati pada suhu kamar. Untuk pengobatan, pengamatan sebelumnya, embrio diobati dengan 5 μM Latrunculin A (ab1444290, Abcam) dalam media F1 1x selama 5 menit atau dengan 3 mM EGTA (E4378, Sigma) dalam medium F1 1x tanpa Ca 2+ selama 20 menit atau dengan 0, 5 μM Calyculin A (208851, EMD Millipore) selama 90 menit dalam medium F1 1x dengan Ca 2+ . Untuk pembungkaman α-catenin, embrio 8 sel secara bersamaan disuntikkan dengan pengkodean RNA untuk biosensor dan dengan 20 ng α-catenin morpholino (ATGTTTTTCTGTATTGAGAGTCATGC 26, Genetools) atau kontrol standar morpholino (CCTCTTTACCTCAGTTACAATTATA).

Untuk imunofluoresensi tidak langsung, embrio difiksasi dengan asam trikloroasetat (TCA) 2% dalam media F1 1X selama 2 jam pada suhu kamar, diditelkan, permeabilisasi dalam PBS ditambah 1% triton X-100 (PBST 1%) selama 10 menit dan jenuh satu jam dalam PBST 0, 1% plus BSA 1% seperti yang dijelaskan sebelumnya 23 . Mereka kemudian diinkubasi dengan antibodi berikut: anti-GFP (I-16, Santa Cruz, clone 7.1 dan 13.1 11 914 460 001, Roche), anti-Xenopus C-cadherin (clone 6B6, DSHB), anti-α-catenin (PA1-25081 Thermo Scientific), anti β-catenin (H102, Sc-7199) atau anti-p120 catenin (sejenis hadiah dari Dr P McCrea). Untuk pelabelan aktin, embrio difiksasi dalam formaldehida 4% selama 2 jam dan diperlakukan seperti dijelaskan di atas. Embrio kemudian diinkubasi dengan (1, 5 U / ml) phalloidin digabungkan dengan AlexaFluor 555 (ThermoFisher Scientific) selama satu jam di PBST 0, 1% plus 1% BSA. Embrio kemudian dibilas dan dipasang di antara dua spacer (Gene Frame) di Vectashield (Vector).

Pencitraan tetap dilakukan menggunakan mikroskop confocal LSM Leica SP8 yang dilengkapi dengan tujuan perendaman minyak 63x / 1, 4 HC PL APO dan garis laser 488 nm, 561 nm. Untuk deteksi, detektor hibrida digunakan. Semua percobaan hewan dilakukan sesuai dengan protokol dan pedoman yang disetujui di Universitas Rennes 1 oleh Comite Rennais d'Ethique en Matière d'Expérimentation Animale (C2EA-07) dan Kementerian Pendidikan dan Penelitian Perancis (3523813).

Pencitraan seumur hidup fluoresensi dan analisis FRET

Semua percobaan FRET dibuat menggunakan sistem FastFLIM (seperti dijelaskan sebelumnya 24 ), menggunakan rencana perendaman minyak APO 63x dengan 1, 4 NA (Leica). Untuk eksitasi donor mTFP1, pita spektral sempit dipilih (445/23 nm) dari laser cahaya putih (Fianium) dan dikirim ke mikroskop melalui cermin dichroic (Di01-T442 / 514/647, Semrock) di dalam kepala pemintalan ( CSUX1, Yokogawa). Emisi mTFP1 kemudian disaring menggunakan filter emisi pada roda filter pemintalan (483/32 nm) dan diperoleh dengan kamera CCD timegated intensif (Picostar, LaVision dan CoolSNAPHQ2, Roper). Lima gerbang temporal 2, 25 ns diperoleh secara berurutan dengan menyesuaikan langkah-demi-langkah penundaan sinyal laser untuk memicu intensifier yang terjaga keamanannya. Waktu pencahayaan kamera CCD dipilih dari 500 ms hingga 2 detik tergantung pada kecerahan sampel. Dua hingga tiga bidang dicitrakan untuk setiap embrio, dan untuk akuisisi selang waktu, gambar diambil setiap menit. Perhitungan FLIM dilakukan secara online menggunakan "flimager", program pengguna buatan yang dikembangkan melalui MetaMorph (Perangkat Molekuler). Semua gambar fluoresensi disajikan sesuai dengan gerbang temporal pertama. Gambar kemudian dianalisis menggunakan perangkat lunak ImageJ (Rasband, WS, //rsb.info.nih.gov/ij), gambar fluoresensi yang digunakan untuk membuat topeng untuk menghilangkan data FLIM dari membran, gambar FLIM yang disaring kemudian digunakan sebagai topeng untuk mengambil gambar fluoresensi dengan hanya piksel yang memiliki nilai FLIM non-nol. Nilai FLIM rata-rata dan intensitas fluoresensi rata-rata kemudian diperoleh dari seluruh bidang gambar yang difilter atau sepanjang garis khusus untuk kimograf.

Untuk analisis pembelahan sel, suatu wilayah yang menarik dari diameter 7 piksel digunakan untuk mengukur masa fluoresensi baik di tempat pembagi, posisi acak pada membran proksimal sel pembagi, atau posisi acak pada membran distal dari non- pembagi sel. Rasio umur fluoresensi di berbagai posisi kemudian dihitung. Persentase kemajuan divisi dinilai dengan mengukur jarak antara dua situs pembagi pada titik waktu yang berbeda. Perbandingan statistik dari nilai FLIM menggunakan uji willcoxon non-parametrik, dan korelasi linear dilakukan dengan menggunakan perangkat lunak R.

informasi tambahan

Cara mengutip artikel ini: Herbomel, G. et al . Ketegangan yang dihasilkan oleh actomyosin pada cadherin serupa antara sel epitel yang membelah dan yang tidak membelah pada embrio awal Xenopus laevis . Sci. Rep. 7, 45058; doi: 10.1038 / srep45058 (2017).

Catatan penerbit: Springer Nature tetap netral sehubungan dengan klaim yurisdiksi dalam peta yang diterbitkan dan afiliasi kelembagaan.

Informasi tambahan

File PDF

  1. 1.

    Bahan Pelengkap

Komentar

Dengan mengirimkan komentar Anda setuju untuk mematuhi Ketentuan dan Pedoman Komunitas kami. Jika Anda menemukan sesuatu yang kasar atau yang tidak mematuhi persyaratan atau pedoman kami, harap tandai sebagai tidak pantas.