Inhibitor mcl-1 molekul kecil yang kuat dan selektif menunjukkan aktivitas membunuh sel kanker sesuai target sebagai agen tunggal dan dalam kombinasi dengan abt-263 (navitoclax) | kematian sel & penyakit

Inhibitor mcl-1 molekul kecil yang kuat dan selektif menunjukkan aktivitas membunuh sel kanker sesuai target sebagai agen tunggal dan dalam kombinasi dengan abt-263 (navitoclax) | kematian sel & penyakit

Anonim

Subjek

  • Apoptosis
  • Terapi obat kombinasi
  • Terapi yang ditargetkan

Abstrak

Protein anti-apoptosis MCL-1 adalah pengatur utama kelangsungan hidup sel kanker dan faktor resistensi yang diketahui untuk molekul kecil penghambat keluarga BCL-2 seperti ABT-263 (navitoclax), menjadikannya target terapi yang menarik. Namun, secara langsung menghambat target ini membutuhkan gangguan interaksi protein-protein afinitas tinggi, dan oleh karena itu merancang molekul kecil yang cukup kuat untuk menghambat MCL-1 dalam sel telah terbukti sangat menantang. Di sini, kami menggambarkan serangkaian asam indole-2-karboksilat, dicontohkan oleh senyawa A-1210477, yang berikatan dengan MCL-1 secara selektif dan dengan afinitas yang cukup untuk mengganggu kompleks MCL-1-BIM dalam sel hidup. A-1210477 menginduksi keunggulan apoptosis intrinsik dan menunjukkan pembunuhan agen tunggal multiple myeloma dan garis sel kanker paru non-sel kecil yang ditunjukkan sebagai MCL-1 tergantung oleh profiling BH3 atau percobaan penyelamatan siRNA. Seperti yang diperkirakan, A-1210477 bersinergi dengan navitoclax inhibitor BCL-2 / BCL-X L untuk membunuh berbagai lini sel kanker. Karya ini merupakan deskripsi pertama dari inhibitor MCL-1 molekul kecil dengan potensi yang cukup untuk menginduksi aktivitas seluler tepat sasaran. Ini juga menunjukkan kegunaan molekul-molekul ini sebagai alat kimia untuk membedah biologi dasar MCL-1 dan janji molekul kecil MCL-1 inhibitor sebagai terapi potensial untuk pengobatan kanker.

Utama

Protein anti-apoptosis seperti BCL-2, BCL-X L dan MCL-1 menjaga kelangsungan hidup sel dengan mengikat dan mengasingkan rekan-rekan pro-apoptosis mereka, seperti BAK, BAX, atau homologi BCL-2 homologi 3 (BH3) - hanya protein BURUK dan BIM. 1, 2, 3 Karena sel-sel kanker harus bertahan hidup di tengah-tengah berbagai tekanan lingkungan, mereka sering mengekspresikan tingkat basal yang tinggi dari kompleks keluarga BCL-2 ini dan telah dideskripsikan sebagai 'prima untuk kematian'. 4 Selama dua dekade terakhir, tim ilmuwan dasar dan translasi telah bekerja untuk menghasilkan penghambat molekul kecil dari interaksi protein-protein ini, dengan tujuan menggerakkan sel kanker untuk memulai apoptosis.

Meskipun membius interaksi ini telah terbukti sangat menantang, upaya berbasis struktur intensif telah memungkinkan desain inhibitor BCL-2 keluarga ampuh dan aktif-sel. ABT-737 adalah di antara molekul pertama yang dijelaskan, 5 diikuti segera setelahnya oleh molekul yang tersedia secara oral, ABT-263 (navitoclax). 6 Kedua molekul meniru BAD, dengan afinitas tinggi untuk BCL-2, BCL-X L dan BCL-W, dan kedua molekul telah menunjukkan aktivitas anti-tumor yang mengesankan secara preklinis. 7, 8 Meskipun navitoclax juga menunjukkan tanda-tanda aktivitas klinis yang menjanjikan, perkembangannya telah diperumit dengan trombositopenia pembatas dosis, akibat penghambatan BCL- XL . 9, 10 Hal ini mendorong pengembangan ABT-199 / GDC-0199 (venetoclax), penghambat selektif BCL-2 yang mempertahankan kemanjuran anti-tumor sambil menjaga trombosit. 11 Inhibitor BCL- XL selektif juga telah dihasilkan 12, 13, 14, 15 dan molekul yang paling kuat A-1155463 dan A-1331852 menunjukkan efek anti-tumor yang signifikan saja atau dalam kombinasi dengan kemoterapi (manuskrip disampaikan).

Tak satu pun dari inhibitor keluarga BCL-2 yang dijelaskan di atas dapat menghambat MCL-1, dan karenanya, tidak mengherankan, protein ini telah muncul sebagai faktor resistensi potensial untuk agen-agen ini. 16, 17, 18, 19 MCL-1 juga telah terlibat dalam memediasi resistensi terhadap berbagai agen kemoterapi yang umum digunakan, 20, 21, 22 dan karenanya menghasilkan molekul kecil yang mampu menghambat MCL-1 merupakan pendekatan yang menarik untuk menghindari resistensi obat . MCL-1 adalah target kanker yang meyakinkan dalam dirinya sendiri, yang telah terlibat dalam memediasi kelangsungan hidup beberapa jenis tumor. 23 Lokus gen MCL1 diperkuat dalam berbagai jenis tumor, termasuk kanker payudara dan kanker paru-paru non-sel kecil (NSCLC), 24 dan protein MCL-1 telah terbukti memediasi kelangsungan hidup dalam model multiple myeloma, 25, 26 leukemia myeloid akut 27 dan NSCLC 28, 29 dan limfoma yang digerakkan oleh MYC. 30

Berbagai pendekatan untuk menghambat MCL-1 telah dijelaskan, termasuk penggunaan BH3 peptida 31, 32, 33, 34 dan molekul kecil 35, 36, 37, 38, 39 yang mengikat MCL-1 secara langsung atau menghambat ekspresinya secara tidak langsung. 18, 40, 41, 42 Dari inhibitor molekul kecil langsung yang dilaporkan, tidak ada yang memiliki afinitas MCL-1 dalam rentang yang diharapkan memberikan efek seluler sesuai target. Inhibitor MCL-1 tidak langsung termasuk inhibitor kinase dependen-siklin seperti roscovitine, flavopiridol, seliciclib, dinaciclib, dan SNS-032, yang menghambat fosforilasi domain R -terminal polimerase 2 C-terminal dan perpanjangan transkrip, termasuk MCL1 . 40, 41, 42 Karena waktu paruh yang singkat (sekitar 30 menit), protein MCL-1 dengan cepat dihilangkan pada pengobatan dengan flavopiridol atau dinaciclib. 40 Anthracyclines seperti daunorubicin juga telah terbukti menekan ekspresi MCL-1. 43 Pertanggungjawaban potensial dari inhibitor MCL-1 tidak langsung adalah bahwa mereka juga mengurangi ekspresi banyak protein berumur pendek lainnya, menjadikannya kurang selektif dan berpotensi lebih toksik.

Di sini kami memperkenalkan serangkaian inhibitor MCL-1 langsung, kuat dan selektif yang menunjukkan aktivitas seluler tepat sasaran, mengganggu kompleks protein MCL-1-BIM dan memicu apoptosis dalam garis sel kanker yang terbukti bergantung pada MCL-1 untuk bertahan hidup. Seperti yang diharapkan, molekul-molekul ini peka terhadap berbagai garis sel tumor terhadap navitoclax inhibitor BCL-2 / BCL-X. Sejauh pengetahuan kami, molekul-molekul ini mewakili inhibitor langsung pertama MCL-1 dengan potensi dan sifat yang dibutuhkan untuk menghambat MCL-1 dalam sel hidup.

Hasil

A-1210477 mengikat MCL-1 dengan afinitas tinggi dan menginduksi peningkatan protein MCL-1 dalam sel

Baru-baru ini, kami menggambarkan sintesis inhibitor molekul kecil MCL-1 yang diuraikan dari inti asam indole-2-karboksilat. 44 Meskipun molekul dengan inti yang sama juga dijelaskan oleh kelompok lain, 38 molekul tersebut kurang dielaborasi, memiliki afinitas yang lebih rendah ( K i > 0, 050 μ M) untuk MCL-1, dan tidak dilaporkan menunjukkan aktivitas seluler. A-1210477 (Gambar Tambahan S1) adalah pengikat kuat MCL-1 ( K i = 0, 000454 μ M dalam tes transfer energi resonansi fluoresensi (TR-FRET) yang mengikat waktu-diselesaikan), mewakili peningkatan afinitas setidaknya dua perintah besarnya di atas molekul tersebut, tetapi merupakan pengikat yang jauh lebih lemah dari BCL-2 ( K i = 0, 132 μ M) dan BCL-X L ( K i > 0, 660 μ M). A-1155905, A-1208746, dan A-1248767 adalah analog yang terkait erat dengan profil afinitas yang serupa (Gambar Tambahan S1 dan Tabel Tambahan S1).

Sebagai tes pertama dari aktivitas seluler potensial dari molekul-molekul ini, kami menilai kemampuan mereka untuk bersaing dengan protein BIM-BH3 hanya untuk mengikat MCL-1 dalam sel H929 menggunakan tes co-immunopresipitasi. Empat jam pengobatan dengan 10 μ M A-1210477 cukup untuk mengurangi jumlah BIM dengan imunopresipitasi dengan antibodi MCL-1, meskipun secara signifikan lebih banyak MCL-1 ditarik dari sel H929 yang diobati dengan A-1210477 relatif terhadap kendaraan. kontrol yang dirawat (Gambar 1a). Setelah menyelidiki efek yang terakhir, kami menemukan bahwa A-1210477 memicu peningkatan MCL-1 dalam berbagai lini sel kanker, termasuk garis sel kanker payudara HCC-1806 (Gambar 1b). Berbeda dengan proteasome inhibitor bortezomib, A-1210477 tidak berpengaruh pada kadar protein NOXA MCL-1-binding. Tidak ada peningkatan mRNA MCL1 yang sesuai yang diamati dalam jangka waktu yang sama, menunjukkan bahwa ini bukan respons transkripsional. Analog A-1210477 A-1248767 menginduksi peningkatan yang bergantung pada konsentrasi serupa pada protein MCL-1 tetapi tidak pada BCL-X L (Gambar 1c). Peningkatan protein MCL-1 dapat diamati pada konsentrasi serendah 0, 5 μ M untuk A-1210477 dan A-1248767, yang memiliki konstanta afinitas MCL-1 dalam kisaran 0, 0004-0, 0005 μ M (Gambar 1b dan c; Tabel Tambahan S1), sedangkan senyawa yang kurang diuraikan seperti A-954248 (K i = 0, 348 μ M) dan A-962653 (K i = 0, 130 μ M) tidak memiliki efek pada level MCL-1 hingga konsentrasi setinggi 20 μ M (Gambar 1c). Menariknya, ekspresi eksogen dari protein pengikat MCL-1 yang diketahui seperti PUMA dan BIM2A telah terbukti menyebabkan peningkatan protein MCL-1 yang serupa, kemungkinan dengan menghalangi ikatan hanya protein BH3 seperti NOXA dan MULE, yang diketahui untuk memediasi ubiquitylation dan degradasi proteasomal MCL-1. 45, 46 Oleh karena itu, data yang ditampilkan di sini memberikan indikasi pertama bahwa molekul-molekul kecil ini bertindak sebagai mimetik BH3 yang secara langsung menargetkan MCL-1.

Image

Level MCL-1 meningkat dalam sel kanker setelah perawatan dengan molekul kecil yang mengikat MCL-1. ( a ) H929 beberapa sel myeloma dirawat selama 4 jam dengan 10 μM A-1210477 sebelum immunopreciptating MCL-1. Immunoprecipitate kemudian dianalisis dengan immunoblotting untuk MCL-1 dan BIM terkait. Lisat H929 kontrol dijalankan di jalur 1, dan imunopresipitasi dengan antibodi non-spesifik (Ig) dijalankan di jalur 2. Posisi penanda berat molekul (ditentukan dalam kiloDaltons) ditunjukkan di sebelah kiri. ( B ) sel kanker payudara HCC-1806 diinkubasi dengan peningkatan konsentrasi A-1210477 (0, 1, 0, 5, 1, 5, 10, 15, atau 20 μ M) atau bortezomib (2, 10, atau 50 nM) selama 8 jam sebelum menilai kadar MCL-1 dan NOXA dengan immunoblotting. β -Actin diperiksa sebagai kontrol pemuatan protein. Grafik yang lebih rendah menggambarkan reverse transcriptase-PCR kuantifikasi MCL1 mRNA dari sel HCC-1806 yang dirawat selama 8 jam dengan konsentrasi yang sama yaitu A-1210477. ( c ) Sel HCC-1806 diinkubasi dengan peningkatan konsentrasi (0, 1, 0, 5, 1, 5, 10, dan 20 μ M) dari A-954248, A-962653, atau A-1248767 selama 24 jam sebelum menilai MCL-1 dan Kadar BCL-X L dengan imunoblotting. β -Actin diperiksa sebagai kontrol pemuatan protein

Gambar ukuran penuh

A-1210477 mengganggu kompleks MCL-1-BIM dalam sel hidup

Pengamatan bahwa A-1210477 dan A-1248767 berperilaku serupa dengan protein hanya BH3 dalam peningkatan kadar MCL-1 menunjukkan bahwa senyawa ini permeabel sel dan mengikat MCL-1 secara langsung. Untuk mengkonfirmasi ini, kami menerapkan berbagai pendekatan ortogonal untuk mengukur efek dari senyawa ini pada kompleks seluler MCL-1-BIM. Kami pertama kali menggunakan protokol co-immunoprec presipitasi-enzyme-linked immunosorbent assay (ELISA), dimulai dengan imunopresipitasi dan tangkapan berbasis MCL-1 dan mitra pengikatannya, diikuti dengan pemeriksaan dengan antibodi BIM dan antibodi sekunder yang memungkinkan elektrokemiluminesensi- berdasarkan kuantifikasi kompleks MCL-1-BIM (lihat Bahan dan Metode). A-1210477 menyebabkan pengurangan dosis-tergantung pada jumlah BIM imunopresipitasi BIM dengan MCL-1, dengan IC 50 dalam kisaran μM rendah (Gambar 2a). Kami mengamati penghambatan yang bergantung pada dosis yang sama dari interaksi MCL-1-NOXA menggunakan sistem dua-hibrida mamalia yang baru-baru ini dijelaskan (Gambar 2b) yang memungkinkan kuantifikasi interaksi protein-protein keluarga BCL-2 dalam sel hidup. 11 A-1210477 menghambat interaksi MCL-1 – NOXA dengan IC 50 sekitar 1 μ M, sementara tidak memiliki efek pada interaksi BCL-2-BIM atau BCL-X L –BCL-XS yang diukur pada latar belakang sel yang sama (Gambar 2b). Analog lain, termasuk A-1155905, menunjukkan selektivitas fungsional yang serupa untuk MCL-1 (Gambar Tambahan S2).

Image

Inhibitor MCL-1 A-1210477 mengganggu kompleks MCL-1-BIM. ( a ) Sel H929 diobati dengan peningkatan konsentrasi A-1210477 selama 4 jam. Antibodi MCL-1 digunakan untuk menangkap MCL-1 dan BIM terkait, yang dideteksi menggunakan uji elektrokemiluminesensi MesoScale. Semua data mewakili rata-rata percobaan rangkap tiga, dengan bar kesalahan menunjukkan SD ( b ) Pengukuran kuantitatif interaksi protein-protein menggunakan uji dua-mamalia berbasis mukalia berbasis luciferase. Sel HeLa secara stabil ditransfeksi dengan reporter luciferase yang digerakkan oleh GAL4 dan mengekspresikan pasangan GAL4DBD-MCL-1: VP16AD-NOXA, VP16AD-BCL-2: GAL4DBD-BIM atau GAL4DBD-BCL- XL : VP16AD-BCL-X diinkubasi dengan peningkatan konsentrasi A-1210477 selama 24 jam. Semua data mewakili cara percobaan rangkap tiga, dengan bar kesalahan menunjukkan S.Ds.

Gambar ukuran penuh

Untuk lebih lanjut mengesampingkan artefak potensial yang terkait dengan deterjen lisat yang dapat mempengaruhi interaksi antara protein keluarga BCL-2, 47 kami menggunakan metode pencitraan real-time yang baru-baru ini dijelaskan untuk menilai efek pada kompleks keluarga BCL-2 dalam sel hidup. Secara singkat, pasangan yang saling berinteraksi dari protein keluarga BCL-2 diekspresikan sebagai protein fusi fluoresen pada tingkat stoikiometrik dari modul ekspresi bikistronik yang diintegrasikan ke dalam satu situs genom dalam sel T-REx-293. Dalam kondisi basal, kedua protein tersebut melokalisasi terutama ke mitokondria, di mana protein anti-apoptosis (protein fluorescent hijau yang ditingkatkan (eGFP) -BCL-2, eGFP-BCL- XL, atau eGFP-MCL-1 (3B)) menyita mereka. rekan pro-apoptosis (mCherry-BAD atau mCherry-BIM S (2A) ΔC, yang terakhir menjadi pengikat spesifik MCL-1 48, 49 ). Gangguan pada komplek ini dapat dilacak dengan mengukur jumlah protein BH3 yang hanya diberi label mCherry yang dilokalisasi secara khusus untuk mitokondria. Jika kompleks protein terganggu oleh mimetik BH3 molekul kecil, sinyal mCherry yang terkait dengan mitokondria berkurang ketika protein fusi hanya BH3 mendistribusikan kembali ke sitosol. Seperti ditunjukkan sebelumnya, 48 inhibitor BCL-2 / BCL-X L ABT-737 menginduksi redistribusi mCherry-BAD yang terkait dengan BCL-2 atau BCL-X L (Gambar 3a dan d). Namun, ABT-737 tidak berpengaruh pada distribusi BIM S (2A) ΔC pada sel yang mengekspresikan MCL-1 (3B) (Gambar 3a, b dan d). Sebaliknya, A-1210477 tidak berpengaruh pada kompleks BCL-2-BAD atau BCL-X L -BAD tetapi menginduksi redistribusi tergantung-dosis dari BIM S (2A) ΔC ke sitosol dalam hitungan menit perawatan (Gambar 3a-c; Gambar Tambahan S3). Efek ini tergantung konsentrasi dan dapat diamati pada konsentrasi serendah 1 μM (Gambar 3b). Dengan demikian data yang dihasilkan dalam empat tes terpisah menunjukkan bahwa A-1210477 dan analog terkaitnya mampu menembus sel-sel hidup dan mengikat MCL-1 secara selektif dan dengan afinitas yang cukup untuk bersaing dengan protein hanya BH3.

Image

A-1210477 menghambat kompleks MCL-1-BIM dalam sel hidup. ( a ) T-REx-293 sel yang secara stabil mengekspresikan eGFP-MCL-1 (3B) dan mCherry-BIM S (2A) ΔC, eGFP-BCL-2 dan mCherry-BAD, atau eGFP-BCL-X L dan mCherry-BAD diperlakukan dengan 10 μ M ABT-737, A-1210477, atau dimethyl sulfoxide (DMSO) dan dicitrakan selama 300 menit. Senyawa ditambahkan setelah akuisisi gambar pertama. Penurunan jumlah protein mCherry-BH3 yang dilokalisasi ke mitokondria dikuantifikasi sebagai fungsi waktu sebagaimana dijelaskan dalam Bahan dan Metode, dinormalisasi ke kontrol DMSO, dan dipasang pada peluruhan eksponensial tunggal. Setiap titik data mewakili perubahan rata-rata intensitas yang dihitung dari 10 bidang pandang, dengan bar kesalahan yang menunjukkan sel SEM ( b ) T-REx-293 yang mengekspresikan eGFP-MCL-1 (3B) dan mCherry-BIM S (2A) ΔC secara stabil diobati dengan 50 μ M ABT-737 atau meningkatkan konsentrasi (1-25 μ M) A-1210477 selama 100 menit. Penurunan jumlah mCherry-BIM S (2A) ΔC terlokalisasi ke mitokondria dikuantifikasi seperti pada panel ( a ). ( c ) Gambar mikroskopis fluoresensi representatif dari sel T-REx-293 yang secara stabil mengekspresikan keluarga eGFP-BCL-2 dan berinteraksi dengan protein mCherry-BH3 saja sebelum dan setelah 300 menit perawatan dengan 10 μ M A-1210477 atau ( d ) ABT- 737. Gambar Grayscale hanya menunjukkan protein fusi mCherry, yang diberi warna merah semu dalam overlay dengan protein fusi eGFP (warna hijau semu). Skala bar mewakili 25 μ m

Gambar ukuran penuh

A-1210477 dan analog terkait menginduksi keunggulan apoptosis pada garis sel kanker yang bergantung pada MCL-1

Untuk memfasilitasi penilaian A-1210477 dan analog asam indole-2-karboksilat terkait, kami berusaha mengidentifikasi garis sel MCL-1 yang akan diprediksi akan menjalani apoptosis sebagai respons terhadap agen-agen ini. Kami mulai dengan menilai beberapa garis sel myeloma, yang telah dilaporkan bergantung pada MCL-1 untuk bertahan hidup. 25, 26 Menggunakan profiling BH3, metode berbasis peptida yang telah digunakan secara luas untuk menentukan ketergantungan keluarga BCL-2, 50 kami menemukan bahwa garis sel H929 menunjukkan profil yang jelas, tergantung pada MCL-1. Sitokrom c dilepaskan dari mitokondria sel H929 permeabilisasi yang diobati dengan peptida BIM2A, yang memiliki afinitas selektif untuk MCL-1, 49 tetapi tidak peptida BAD, yang menargetkan BCL-2, BCL-X L dan BCL-W (Gambar 4a ). Ketika sel H929 yang utuh diperlakukan dengan analog A-1210477 A-1208746, sitokrom c diamati dalam fraksi sitosol dalam waktu 4 jam pada konsentrasi serendah 3 μ M (Gambar 4a), yang menunjukkan bahwa senyawa ini dapat memulai apoptosis pada MCL-1 sel -dependen. Seperti yang diharapkan, A-1155905, A-1208746, dan A-1210477 masing-masing membunuh sel H929 dengan nilai IC 50 dalam kisaran μM rendah, sementara tidak memiliki efek pada garis sel RS4; 11 (Gambar 4b), yang dikenal mengandalkan BCL-2 untuk bertahan hidup. 11, 51 Data ini menunjukkan bahwa senyawa ini secara selektif membunuh garis sel MCL-1-dependen.

Image

Asam Indole-2-karboksilat menginduksi keunggulan apoptosis pada garis sel kanker yang bergantung pada MCL-1 H929. ( a ) Sel H929 digitonin-permeabil diperlakukan dengan 10 μ M BH3 peptida selama 4 jam, dan sel H929 utuh diinkubasi dengan peningkatan konsentrasi (0, 1-10 μ M) dari A-1208746 selama 4 jam sebelum menilai tingkat sitokrom c. dilepaskan ke dalam sitosol. ( B ) H929 dan RS4; 11 sel diinkubasi dengan peningkatan konsentrasi MCL-1 inhibitor atau BCL-2-selective inhibitor ABT-199 (venetoclax) selama 48 jam sebelum menentukan viabilitas sel. Pembunuhan sel IC 50s diplot dengan masing-masing nilai mewakili rata-rata dari tiga percobaan terpisah. Error bar mewakili SEM ( c ) H929 sel diinkubasi dengan peningkatan konsentrasi MCL-1 inhibitor dengan ada atau tidak adanya inhibitor pan-caspase QVD (100 μ M) selama 4 jam sebelum menilai aktivasi caspase-3 / -7, polarisasi membran mitokondria, dan paparan fosfatidilserin. Data mewakili rata-rata percobaan rangkap tiga, dengan bar kesalahan menunjukkan SEM

Gambar ukuran penuh

Untuk mengkonfirmasi bahwa senyawa ini bekerja dengan mekanisme, kami melakukan serangkaian tes yang dirancang untuk menilai peristiwa berurutan yang terjadi selama aktivasi jalur apoptosis intrinsik. A-1155905, A-1208746, A-1210477, dan A-1248767 menginduksi keunggulan apoptosis dalam garis sel H929 yang bergantung pada MCL, termasuk depolarisasi membran mitokondria, aktivasi caspase-3 / -7, dan eksternalisasi phosphatidylserine pada permukaan sel (Gambar 4c). Pretreatment dengan inhibitor pan-caspase QVD menghambat eksternalisasi fosfatidilserin, lebih lanjut menunjukkan bahwa kematian sel yang disebabkan oleh senyawa-senyawa ini bergantung pada caspase dan terjadi oleh apoptosis. Lebih lanjut, senyawa-senyawa ini tidak membunuh fibroblast embrionik murine yang tidak memiliki protein efektor apoptosis, Bak dan Bax (Gambar Tambahan S4), menunjukkan bahwa mereka tidak membunuh sel secara membabi buta melalui mekanisme non-apoptosis.

Kami selanjutnya meneliti efek dari molekul-molekul ini dalam pemilihan garis sel tumor padat yang dilaporkan bergantung pada MCL-1 untuk bertahan hidup, termasuk garis sel NSCLC H2110 dan H23. 24, 29 percobaan penyelamatan siRNA (Gambar 5a dan c) dan profiling BH3 (Gambar 5e) mengkonfirmasi bahwa garis sel ini bergantung pada MCL-1 untuk bertahan hidup. Kedua garis sel sensitif (viabilitas sel IC 50 <10 μ M) terhadap A-1210477 (Gambar 5b dan d), yang menyatakan bahwa senyawa ini dapat membunuh garis sel yang bergantung pada MCL-1.

Image

A-1210477 membunuh garis sel kanker NSCLC yang bergantung pada MCL-1. Garis sel NSCLC ( a ) H2110 atau ( c ) H23 ditransfeksi dengan konstruksi yang mengekspresikan CDS MCL1 yang ditandai dengan Flag epitope atau vektor kontrol kosong. Sel-sel ini kemudian ditransfusikan dengan siRNA yang menargetkan CDS MCL1 , MCL1 3 ′ UTRa atau UTRb, atau urutan kontrol yang diacak. Viabilitas sel dinilai 72 jam kemudian dengan MCL-1 dan Flag immunoblots dilakukan secara paralel. ( B ) H2110 atau ( d ) H23 sel diobati dengan peningkatan konsentrasi A-1210477 selama 72 jam sebelum menilai kelayakan sel. Semua titik data mewakili cara percobaan rangkap tiga, dengan bar kesalahan yang menunjukkan SEM ( e ) sel H23 yang permeabilisasi-permeabilisasi diperlakukan dengan 10 μM BH3 peptida selama 4 jam sebelum mengisolasi fraksi sitosol, yang diimunoblot menggunakan antibodi sitokrom c.

Gambar ukuran penuh

A-1210477 bersinergi dengan navitoclax untuk menginduksi apoptosis pada beberapa garis sel kanker

MCL-1 telah ditandai dengan baik sebagai faktor resistensi untuk inhibitor BCL-2 / BCL-X L ABT-737 dan navitoclax. Ada banyak contoh penghambatan MCL-1, biasanya melalui knockdown yang dimediasi siRNA, menyadarkan garis sel kanker untuk membunuh oleh ABT-737. 16, 17, 18, 19, 52 Oleh karena itu kami menguji kombinasi navitoclax dan A-1210477 dalam panel garis sel kanker yang diketahui bergantung pada BCL-X L dan MCL-1 untuk bertahan hidup, misalnya, garis sel kanker lambung EJ-1. 19, 52 Seperti yang diharapkan, navitoclax memiliki sedikit atau tidak ada efek pada garis sel hingga 3-5 μM , konsentrasi yang biasanya akan membunuh sel-sel yang bergantung pada BCL-2 dan / atau BCL-X L saja (Gambar 6). A-1210477 secara substansial menggeser kurva dosis-respons navitoclax dalam sel BxPC-3, EJ-1, H23, dan OPM-2, menunjukkan kemampuan untuk mempotensiasi efek penghambatan BCL-2 / BCL- XL . Memang, analisis aditif Bliss menunjukkan bahwa kombinasi ini sangat sinergis. Data ini lebih lanjut menunjukkan bahwa molekul asam indol-2-karboksilat yang diuraikan di sini memang merupakan penghambat sel-aktif MCL-1 yang berperilaku seperti yang diperkirakan dalam kepekaan sel kanker terhadap efek inhibitor BCL-2 / BCL- XL .

Image

A-1210477 bersinergi dengan navitoclax untuk membunuh garis sel tumor yang hematologis dan padat. Sel BxPC-3, EJ-1, H23, dan OPM-2 diobati dengan peningkatan konsentrasi navitoclax dengan ada atau tidak adanya peningkatan konsentrasi A-1210477 selama 48 jam sebelum menilai kelayakan sel. Semua titik data mewakili cara percobaan rangkap tiga, dengan bar kesalahan menunjukkan SEM

Gambar ukuran penuh

Diskusi

Mimetik BH3 molekul kecil seperti ABT-737, ABT-263 (navitoclax), dan ABT-199 (venetoclax) telah digunakan secara luas untuk menjelaskan fungsi BCL-2 dan BCL-X L dalam tumor dan kelangsungan hidup sel normal. Navitoclax dan BCL-2-selective inhibitor venetoclax juga sedang diuji di klinik, di mana mereka menunjukkan aktivitas anti-tumor pada kanker hematologi. Baru-baru ini, inhibitor selektif BCL-X L juga telah dijelaskan. 12, 13, 14, 15 MCL-1 cenderung menjadi faktor resistensi untuk semua senyawa ini dan mewakili target kanker yang menarik dalam dirinya sendiri. Namun, menghasilkan inhibitor langsung MCL-1 dengan sifat-sifat yang diperlukan untuk aktivitas berbasis sel on-target telah terbukti menjadi tantangan utama. Meskipun diduga inhibitor MCL-1 telah dijelaskan, 35, 36, 37, 38, 39, 53, 54 bukti kuat bahwa mereka bertindak berdasarkan mekanisme masih kurang. Dalam pengalaman kami, sub-nanomolar, dan sering picomolar rendah, afinitas diperlukan untuk molekul kecil untuk bersaing dengan ligan endogen berafinitas tinggi untuk mengikat protein anti-apoptosis, seperti BCL-2 dan BCL-X L. Karena tidak ada molekul kecil yang dijelaskan sampai saat ini memiliki afinitas pengikat MCL-1 dalam kisaran ini, tidak mungkin bahwa mereka mampu secara langsung menghambat MCL-1 dalam konteks seluler, dan memang, mekanisme beberapa molekul ini telah dipertanyakan. 55, 56, 57, 58

Di sini kami menggambarkan inhibitor molekul kecil selektif pertama MCL-1 dengan afinitas yang diperlukan untuk memberi aktivitas seluler target. Molekul-molekul ini, dicontohkan oleh A-1210477, mengikat MCL-1 dengan afinitas sub-nanomolar dan menunjukkan kemampuan untuk mengganggu interaksi protein MCL-1-BH3 endogen hanya dalam empat uji biologis yang berbeda. Menggunakan tes dua-hibrida mamalia dan platform pencitraan sel yang melacak interaksi keluarga BCL-2 secara real time, kami menemukan bahwa A-1210477 secara selektif dapat mengganggu kompleks MCL-1-NOXA dan MCL-1-BIM2A dalam sel hidup. Menariknya, analog asam A-1210477 dan indole-2-karboksilat dengan afinitas sub-nanomolar yang serupa untuk MCL-1 berperilaku mirip dengan protein BH3 yang diekspresikan secara eksogen, menyebabkan peningkatan konsentrasi tergantung pada protein MCL-1 yang dapat diamati mulai dari konsentrasi sub- μ M. Namun, analog A-962653 yang kurang diuraikan, yang mengikat MCL-1 dengan afinitas yang lebih rendah ( K i = 130 nM) dibandingkan dengan inhibitor MCL-1 lainnya yang dijelaskan baru-baru ini, tidak memiliki efek. A-1210477 juga mengaktifkan jalur apoptosis intrinsik dalam jalur sel kanker yang bergantung pada MCL-1, memicu pelepasan sitokrom c dari mitokondria, aktivasi caspase-3 / -7, dan eksternalisasi fosfatidilserin dalam beberapa jam. Akhirnya, senyawa-senyawa ini secara selektif membunuh garis sel kanker yang bergantung pada MCL-1 (H929, H2110 dan H23) dan bersinergi dengan navitoclax inhibitor BCL-2 / BCL-X untuk membunuh garis sel yang bergantung pada beberapa anggota keluarga BCL-2 untuk bertahan hidup (BxPC-3, EJ-1, OPM-2).

Meskipun penghambat MCL-1 putatif lain telah terbukti menginduksi jalur apoptosis intrinsik, ini tidak membuktikan bahwa mereka bertindak langsung pada MCL-1. Di tangan kami, mimetik BH3 sejati, seperti navitoclax, venetoclax, dan A-1155463, menginduksi tanda-tanda apoptosis dalam 2-4 jam aplikasi pada populasi sel yang sensitif. 6, 11, 15 Sejumlah mekanisme tidak langsung dapat menyebabkan apoptosis dalam periode waktu yang lebih lama, dan fakta bahwa molekul tertentu melibatkan jalur apoptosis intrinsik, seringkali setelah  24 jam pengobatan, tidak cukup untuk menunjukkan bahwa itu adalah penghambat keluarga BCL-2 langsung. Selain itu, perawatan harus diambil dalam memilih garis sel yang digunakan untuk menilai aktivitas sesuai target. Konfirmasi bahwa sel-sel sebenarnya bergantung pada MCL-1 untuk kelangsungan hidup sangat penting jika mereka akan digunakan sebagai standar untuk menguji putative inhibitor MCL-1. Kami menggunakan kombinasi pendekatan biokimia (profiling BH3) dan biologi sel / molekuler (penyelamatan siRNA) untuk memvalidasi ketergantungan MCL-1 dari garis sel seperti H929, H2110, dan H23, yang dengan demikian dianggap dapat diandalkan untuk menilai efek diduga. Inhibitor MCL-1. Sayangnya, garis sel yang divalidasi tidak selalu digunakan untuk menilai inhibitor MCL-1 putatif lainnya. Memang, dalam satu kasus, garis sel yang digunakan untuk menilai penghambatan target yang dimediasi-inhibitor dan pembunuhan sel pada dasarnya terbukti tidak terpengaruh ketika protein MCL-1 benar-benar dirobohkan selama 72 jam. 37 Contoh-contoh ini menunjukkan beberapa tantangan dan perangkap yang terlibat dengan memvalidasi inhibitor molekul kecil sebagai probe biologis yang andal.

Workman dan Collins 59 baru-baru ini mengkaji pembelajaran biologi kimia dan komunitas penemuan obat selama beberapa dekade dalam mensintesis dan mengimplementasikan inhibitor molekul kecil sebagai penyelidikan untuk pembedahan biologi, validasi target terapi, dan pengembangan terapi yang disetujui. Mereka menggambarkan serangkaian 'faktor kebugaran', yang meliputi selektivitas, potensi, dan sifat kimia, yang harus dipertimbangkan ketika menilai kegunaan probe dalam konteks biologis tertentu. Seperti diperlihatkan di sini, A-1210477 dan analog-analognya yang berkaitan erat memenuhi kriteria ini: mereka mengikat MCL-1 dengan selektivitas tinggi relatif terhadap protein keluarga BCL-2 lainnya (dan juga berbagai kinase dan GPCR; data tidak ditampilkan), menunjukkan sub afinitas nanomolar untuk MCL-1 dalam uji biokimia, dan mampu menghambat MCL-1 langsung dalam sel pada konsentrasi mikromolar rendah. Perbedaan antara afinitas target dan potensi seluler dapat setidaknya sebagian dikaitkan dengan sifat fisikokimia. Sebagai contoh, sifat zwitterionik dari farmakofor dapat memaksakan batasan pada difusi membran pasif ( 60) dan, mirip dengan penghambat keluarga BCL-2 lainnya, 15 A-1210477 dan analog yang terkait sangat terikat protein. Ini dicerminkan oleh pergeseran> 15 kali lipat dalam afinitas MCL-1 dengan adanya 10% serum manusia dan pengikatan protein manusia terukur> 99%. 44 Molekul-molekul ini menginduksi semua tanda yang diharapkan dari apoptosis intrinsik dalam garis sel MCL-1 dan berperilaku seperti yang diharapkan dalam konteks sel yang bergantung pada MCL-1 untuk resistensi terhadap navitoclax inhibitor BCL-2 / BCL-X. Oleh karena itu banyaknya bukti yang disajikan dalam penelitian ini menunjukkan bahwa molekul-molekul ini bertindak sesuai target dan karenanya merupakan alat yang andal untuk menyelidiki fungsi MCL-1 secara in vitro .

Pertanyaan kunci yang tetap tidak terjawab oleh penelitian ini adalah apakah jaringan normal dapat mentolerir penghambatan MCL-1 pada tingkat yang diperlukan untuk manfaat terapeutik. Prediksi terbaik tentang potensi toksisitas sesuai target datang dari model KO Mcl-1. Berdasarkan studi ini, toksisitas jantung, hati, dan hematologi mungkin diantisipasi untuk inhibitor MCL-1 molekul kecil. 61, 62, 63, 64, 65, 66, 67, 68 Namun, karena MCL-1 dapat melakukan fungsi-fungsi penting yang tidak terkait dengan sekuestrasi protein pro-apoptosis, 23, 69 tetap mungkin bahwa penghambatan dengan mimetik BH3 molekul kecil mungkin lebih baik ditoleransi daripada hilangnya protein MCL-1. Mungkin juga kemanjuran anti-tumor dapat dicapai melalui penghambatan parsial MCL-1, yang bisa jadi kurang toksik. Memang, inisiasi tumor yang digerakkan oleh MYC secara signifikan dihambat oleh KO dari alel tunggal Mcl-1 , meskipun jaringan normal tetap tidak terpengaruh. 30, 70 Untuk saat ini, pembuktian konsep formal harus menunggu generasi penghambat MCL-1 yang lebih kuat dengan sifat seperti obat yang lebih baik. Namun demikian, A-1210477 dan molekul lain yang diuraikan di sini adalah mimetik BH3 selektif MCL-1-selektif dengan potensi yang cukup untuk menunjukkan aktivitas sel yang tepat sasaran. Senyawa-senyawa ini akan menjadi alat yang sangat berharga bagi komunitas penelitian dan mewakili tonggak sejarah lain dalam mencari perawatan yang ditargetkan yang akan menguntungkan pasien dengan kebutuhan medis yang belum terpenuhi.

Material dan metode

Budaya sel

Semua NSCLC manusia, kanker paru-paru sel kecil, kanker kerongkongan dan beberapa garis sel myeloma diperoleh dari ATCC (Manassas, VA, USA) dan dikultur sesuai dengan spesifikasi vendor. Sel T-REx-293 diperoleh dari Life Technologies (Carlsbad, CA, USA) dan dipertahankan seperti yang dijelaskan sebelumnya. 48

Uji proliferasi dan viabilitas sel

Garis sel yang melekat diunggulkan pada 50.000 sel per sumur dalam pelat 96 lubang dan dirawat selama 48 jam dengan senyawa yang diencerkan dalam langkah setengah log mulai dari 30 μ M dan berakhir pada 0, 001 μ M. Beberapa garis sel myeloma diunggulkan pada 15.000 –20.000 sel per sumur dan diperlakukan serupa. Efek pada proliferasi dan viabilitas ditentukan menggunakan reagen CellTiter-Glo dari Promega (Madison, WI, USA) sesuai dengan instruksi pabrik. Nilai IC 50 ditentukan oleh analisis regresi non-linear dari data respons konsentrasi.

Uji redistribusi sel

Eksperimen dilakukan sebagaimana dirinci sebelumnya. 48 Pencitraan dilakukan dengan tujuan × 40 ELWD Plan Fluor objektif (NA: 0, 6, Nikon, Melville, NY, USA) pada mikroskop terbalik fokus sempurna Ti-E Nikon yang dilengkapi dengan cakram pemutar disk yang berputar CSU-X1 (Andor, Oxford Instruments, Belfast, Inggris), bermotor X, panggung Y (Nikon), ruang lingkungan (OkoLab, Pozzuoli, Italia), dan kamera EMCCD iXon3 897 (Andor, Oxford Instruments), dikendalikan oleh perangkat lunak NIS-Elements (Nikon). Semua analisis dilakukan menggunakan MATLAB (versi R2012b, Mathworks, Natick, MA, USA) pada gambar grayscale 16-bit dari protein keluarga eGFP-BCL-2 atau protein mCherry-BH3 saja. Kompartemen mitokondria diidentifikasi sebagai eGFP-localized, kecil, struktur terisolasi (> ~ 4 μm 2 dan <80 μm 2 ) di atas intensitas latar belakang lokal. Berbeda dengan Wong et al. , 48 area spesifik-nuklir tidak diamati. Oleh karena itu, seluruh sel diidentifikasi dengan ambang batas intensitas tunggal yang diterapkan pada fluoresensi eGFP, tidak termasuk area yang diidentifikasi sebagai mitokondria. Intensitas rata-rata dilaporkan berdasarkan gambar-lebar, dinormalisasi ke total area setiap kompartemen yang diidentifikasi. Rasio intensitas mitokondria mCherry / intensitas sitoplasma dihitung, dan data dinormalisasi dan diplot seperti yang dijelaskan. 48 Data dianalisis dari 10 bidang pandang per kondisi dalam dua percobaan terpisah.

Antibodi dan reagen

Antibodi untuk studi ko-imunopresipitasi MCL-1-BIM diperoleh dari Thermo Fisher Scientific (Waltham, MA, USA; anti-MCL-1 clone RC13) dan Abcam (Cambridge, MA, USA; anti-BIM clone Y36). Antibodi anti-kelinci-HRP dan anti-tikus-HRP sekunder dibeli dari Amersham Biosciences (Piscataway, NJ, USA). Semua bahan kimia dibeli dari Sigma (St. Louis, MO, USA). Antibodi untuk imunoblot diperoleh dari Abcam (anti-NOXA clone 114C307), Biosains BD (San Jose, CA, USA; anti-BCL-X L clone 4), Sigma (anti- β -actin clone AC-15) dan Santa Cruz (La Jolla, CA, AS; klon anti-MCL-1 S-19).

transeksi siRNA dan percobaan penyelamatan

siRNA yang menargetkan MCL1 diperoleh dari Dharmacon (Lafayette, CO, USA) atau Qiagen (Valencia, CA, USA). Urutannya adalah sebagai berikut: urutan pengkodean (CDS; Dharmacon) GCAUCGAACCAUUAGCAGAUU, wilayah yang tidak diterjemahkan a (UTRa) (Dharmacon) CGAAGGAAGUAUCGAAUUU, dan UTRb (Qiagen) CCCGCCGAAUUCAUUAAUAUAAUUA. Sel-sel diunggulkan ke dalam cawan 10 cm pada 1, 5x106 per cawan sehari sebelum transfeksi. Untuk setiap transfeksi, 12, 5 μl dari 20 μM stok siRNA dicampur dengan 1, 4 ml Opti-MEM (Invitrogen, Carlsbad, CA, USA) selama 5 menit pada suhu kamar. Secara keseluruhan, 22, 4 μl Lipofectamine 2000 (Invitrogen) juga dicampur dengan 1, 4 ml Opti-MEM selama 5 menit. Kedua larutan kemudian dicampur selama 30 menit sebelum ditambahkan ke sel-sel yang dicakup oleh 2, 2 ml medium (konsentrasi siRNA akhir 50 nM). Setelah 4 jam inkubasi pada suhu 37 ° C, larutan transfeksi dikeluarkan dan diganti dengan media segar. Lisis sel disiapkan 3 hari kemudian.

Mengikat tes afinitas

Uji afinitas pengikatan TR-FRET dilakukan untuk BCL-2, BCL-X L, dan MCL-1 dalam 4, 52 mM kalium fosfat monobasa, 15, 48 mM kalium fosfat dibasat, 1 mM natrium EDTA, 0, 05% deterjen Pluronic F-68, 50 mM natrium klorida, dan 1 mM DTT (pH 7, 5) seperti yang dijelaskan sebelumnya untuk BCL-X L. 6 Untuk pengujian MCL-1, MCL-1 yang diberi tag GST (1 nM) dicampur dengan 100 nM f-Bak, antibodi anti-GST berlabel Tb 1M, dan senyawa pada suhu kamar (RT) selama 60 menit. Fluoresensi diukur pada pembaca pelat Envision (Perkin-Elmer, Waltham, MA, USA) menggunakan filter eksitasi 340/35 nm dan 520/525 (f-Bak) dan 495/510 nm (antibodi anti-GST berlabel Tb) filter emisi.

Hibrida dua mamalia

Sel HeLa yang secara stabil mengekspresikan reporter GAL4-luciferase diunggulkan ke dalam piringan 10 cm pada sel 5 × 10 5 per piringan. Secara keseluruhan, 24 μg plasmid mengekspresikan protein fusi 'umpan' dan 'mangsa' (GAL4DBD-BIM dan VP16AD-BCL-2, GAL4DBD-BCL-X L dan VP16AD-BCL-X S, atau GAL4DBD-MCL -1 dan VP16AD-NOXA, masing-masing) dicampur dengan 1, 5 ml OptiMEM (Invitrogen). Secara terpisah, 24 μL Lipofectamine 2000 (Invitrogen) dicampur dengan 1, 5 ml OptiMEM. Kedua solusi diinkubasi selama 5 menit (RT) dan kemudian dicampur bersama selama 20 menit. Tiga mililiter campuran ditambahkan ke sel-sel dalam media kultur 12 ml yang kekurangan antibiotik, diinkubasi pada suhu 37 ° C selama 24 jam, dan kemudian dipindahkan ke pelat 96-sumur pada 20.000 sel per sumur. Senyawa ditambahkan dalam pengenceran setengah log, mulai dari 1 μ M dan berakhir pada 0.0001 μ M selama 24 jam, dan aktivitas luciferase dinilai menggunakan reagen ONE-Glo (Promega). Semua data diplot sebagai persentase kompleks yang tersisa relatif terhadap kontrol yang tidak diobati.

ELISA Electrochemiluminescent

Setelah perawatan senyawa, sel-sel dilisiskan dalam buffer yang mengandung 1% CHAPS, 10 mM HEPES, dan 150 mM NaCl dengan protease inhibitor cocktail (Roche, Indianapolis, IN, USA). Secara keseluruhan, 100 μg sel lisat ditambahkan ke setiap sumur dari Meso Scale Discovery (Rockville, MD, USA) 96-well plate yang di-preoated dengan antibodi anti-MCL-1 biotinylated (clone RC13) dari Thermo Fisher Scientific. Kompleks MCL-1-BIM terdeteksi dengan antibodi anti-BIM kelinci (klon Y36) dari Abcam, diikuti oleh antibodi anti-kelinci berlabel Sulfo (Meso Scale Discovery; kucing no. R32AB-5) dan buffer pembacaan pembacaan Meso Scale dengan surfaktan (cat. no. R92TC-2) sesuai dengan rekomendasi pabrikan. Setiap langkah diikuti dengan mencuci tiga kali dengan PBS-T (PBS + 0, 1% Tween-20).

Ekstraksi protein dan analisis imunoblot

Sel-sel dikerik menjadi PBS dingin, dipelet, dan kemudian disuspensikan kembali dalam 100-200 μl buffer lisis sel serangga sedingin es yang dilengkapi dengan protease inhibitor (BD Biosciences Pharmingen, San Diego, CA, USA). Sel-sel dilisiskan dengan sonication, dan puing-puing dibersihkan dalam microcentrifuge. Secara keseluruhan, 40 g lisat dimuat di masing-masing sumur 6 atau 10% Tris-Glycine polyacrylamide minigels (Invitrogen) untuk analisis SDS-PAGE. Protein dipindahkan ke membran PVDF (Invitrogen), diblokir selama 1 jam dalam TBS-T ditambah 5% (berat / berat) susu bubuk blotting (Laboratorium Bio-Rad, Hercules, CA, USA), dan kemudian diperiksa semalam pada suhu 4 ° C dengan antibodi primer pada pengenceran 1: 2000 dalam larutan pemblokiran. Bercak dikembangkan menggunakan reagen chemiluminescence (ECL Plus) yang disempurnakan dari Amersham Biosciences.

Mekanisme studi tindakan

Sel-sel H929 dikultur dalam RPMI 1640 (Invitrogen Corp, Grand Island, NY, USA) yang dilengkapi dengan 10% serum janin sapi (Invitrogen), 1% natrium piruvat, 25 mM HEPES, 4, 5 g / l glukosa, dan 1% penisilin / streptomisin (Sigma) dan dipertahankan dalam ruang yang dilembabkan pada 37 ° C yang mengandung 5% CO 2 . Untuk menilai pelepasan sitokrom, 1 × 10 6 H929 sel dirawat selama 4 jam dengan peptida BH3 (10 μ M) atau senyawa (pengenceran setengah log mulai dari 10, 0 μ M dan berakhir pada 0, 1 M) sebelum menghasilkan mitokondria dan sitosol fraksi seperti yang dijelaskan sebelumnya. 11 Untuk semua penelitian lain, sel-sel H929 dilapisi dalam pelat kultur jaringan 96-well pada 100.000 sel / baik dalam 100 μl RPMI yang dilengkapi dengan 10% FBS. Aktivasi caspase diblokir menggunakan penghambat pan-caspase Q-VD-OPh hidrat (QVD; Sigma). QVD (40 mM stock di DMSO) ditambahkan ke sumur yang sesuai untuk konsentrasi akhir 100 μ M menggunakan dispenser digital HP D300 (Tecan, Männedorf, Switzerland), dan sel-sel tersebut di pretreasi selama 1 jam sebelum menambahkan senyawa tambahan . Senyawa selektif MCL-1 (stok 10 mM dalam DMSO) ditambahkan menggunakan dispenser digital HP D300, dan sel-sel diperlakukan selama 4 jam tambahan. Setelah perawatan, ciri-ciri apoptosis (aktivasi caspase-3 / -7, depolarisasi membran mitokondria, dan eksternalisasi fosfatidilserin) diukur menggunakan IntelliCyt (Albuquerque, NM, USA) MultiCyt 4-Plex Apoptosis Screening Kit sesuai dengan instruksi pabrik dibaca oleh flow cytometry menggunakan sistem penyaringan HTFC (IntelliCyt). Secara singkat, 20 μl sel yang diolah dipindahkan ke pelat bawah-96-sumur V yang berisi koktail 20 μl yang terdiri dari kombinasi pewarna dan diinkubasi selama 1 jam pada suhu 37 ° C sebelum membaca. Data dinyatakan sebagai persentase sel singlet. Untuk sisa 80 μl sel yang dirawat, viabilitas ditentukan menggunakan pereaksi CellTiter-Glo (Promega).

Informasi tambahan

File Powerpoint

  1. 1.

    Informasi tambahan

Dokumen Word

  1. 1.

    Informasi tambahan

Glosarium

BH3

Homologi BCL-2 3

CDS

urutan pengkodean

eGFP

peningkatan protein fluoresen hijau

ELISA

enzyme-linked Immunosorbent Assay

NSCLC

kanker paru-paru bukan sel kecil

TR-FRET

transfer energi resonansi fluoresensi diselesaikan waktu

UTR

wilayah yang tidak diterjemahkan

Informasi Tambahan menyertai makalah ini di situs web Kematian dan Penyakit Sel (//www.nature.com/cddis)